What is a concentration of mineral fragments at the bottom of a streambed called? Choose the correct answer.
O nodule
O placer deposit
O native element
O hydrothermal solution

Answers

Answer 1

Answer:

B. Placer deposit

Explanation:

Quizlet called "7-1 Science Mineral Resources" with answers


Related Questions

Suggest reasons for the color patterns of the frog and its lack of color on the ventral surface.

Answers

Answer:

To save itself.

Explanation:

The color patterns of the frog and its lack of color on the ventral surface allows the frog to protect itself from their predators because the frog changes its colour and the predators are unable to see them. The color patterns of frogs and their lack of color on the ventral surface allow frogs to escape from their predators. If the frog does not change its colour, the predators will see them and the frog will be catch by its predators and feed on them so this is the reason that frog changes colour or the presence of colour patterns.

In a sample of double stranded dna if 19% of the nitrogenous bases are guanine what percent of the nitrogenous bases are adenine

Answers

Answer:

31%

Explanation:

Chargaff's law says the amount of A (adenine) = T (thymine) and G (guanine) = C (cytosine). If

G = 19% then C= 19%

19% + 19% = 38%

100% - 38% = 62%

62% for A and T

Divide by 2 and you get

31%

In Amish populations, we see a much higher amount of a specific type of dwarfism compared to the rest of the human population. Which term is best applies to this situation?




Both of these

Genetic Drift

Founder Effect

None of these

Answers

Answer: Both of these

Explanation: trust me

What do decomposers leave behind after getting their energy?
А
chlorophyll and vitamins
B
carbon dioxide and water molecules
C С
elements like carbon, nitrogen and phosphorus
D
energy-rich carbohydrates
Q

Answers

Answer:

Carbon and nitrogen

Explanation:

Decomposers gain energy and nutrients and energy by breaking down dead organisms and animal waste. Through that process they release nutrients. Which are carbon and nitrogen. To give nutrients to the ecosystem.

Answer:

carbon and dioxide,nitrogen and phosphorus

Explanation:

it's right 100% did the ap3x quiz

Describe how the picture below represents the function of the immune system

Answers

Answer:

The Human Immune system helps fight bacteria and germs and viruses because without the Immune system we could die it is what protects us from The flu and sometimes cov id with a weak immune system we might no survive.

Explanation:

what was explained by darwins theory of biological evolution

Answers

Answer:

When Organism A has a trait that negatively impacts it, or lacks a trait which would positively impact it, then said organism perishes, and its genes are not passed onto the next generation. On the flip side, when Organism B has a trait that positively impacts it, or lacks a trait that would negatively impact it, then the organism thrives, and its genes are passed onto the next generation.

Therefore, the next generation receives genes from Organism B and does not receive genes from Organism A. So, the next generation has traits that positively impact it and lacks traits that would negatively impact it, thus evolving according to Darwin.

Explanation:

What was explained by it? Evolution. But how did it explain evolution? That is in the answer.

Which part of a DNA molecule is responsible for the direct coding of specific traits in an organism?

Answers

Answer:

i dont know i need points

Explanation:

The transfer of heat is responsible for many of the events that occur on Earth. Which of the following events is most directly caused by radiation from the Sun?

the circulation of air

the warming of Earth’s surface

the movement of ocean currents

the movement within Earth’s mantle

Answers

Answer:

the circulation of air

Explanation:

air is from a sun

И a whole

The cell of
an elephant will be not be larger than that of an ant give reasons?​

Answers

The cell of an elephant will not be larger than the cell of an ant because the size of an animal cell is more or less the same in every animal cell. ... For example, the size of muscle cell and the size of nerve cell will differ from one another because of their function rather than the animals in which they are found.

Answer:

Explanation:

The cell of  an elephant will be not be larger than that of an ant.

This is because the shape and size of the cell does not depend on the body of the organism but on the function that the cell performs.

So the cell of the elephant will not be larger than that of an ant.

Hope it helps!

Please mark as brainliest!

Who ever Answer this right will get brainliest ​

Answers

Answer:

See Explanation

Explanation:

Pathogens are disease causing organisms in the body. They attack diverse cells, organs, tissues and systems in the body thereby causing them to malfunction (to become diseased).

Antibodies are the body's natural protective mechanism against pathogens.  Antibodies engulf these pathogens and digest them. Then they produce certain chemicals called antitoxins which now destroy the toxins produced by these pathogens in the body.

Also they activate the systems involved in fighting pathogens by punching the cell wall of invading pathogens.

Biodiversity
8
A farmer who owns a large fruit orchard has noticed that certain tree species in his orchard are failing to produce fruit and are slowly
dying. This has caused a decrease in the variety of fruit available for him to sell to consumers. Which of the following changes has
most likely caused this change in biodiversity?
OA
increased soil aeration due to an increase in earthworm populations
OB
decreased rainfall due to a prolonged period of drought
OC. decreased competition for space due to the removal of weeds
OD
increased pollination due to an increase in pollinator populations

Answers

Answer:

OA increased soil aeration due to an increase in earthworm populations.

Answer:

it is B. decreased rainfall due to a prolonged period of drought

Explanation:

trust me i got it right on my quiz

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Answers

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

During a study session about evolution, one of your fellow students remarks "The giraffe stretched its neck while reaching for higher leaves, its offspring inherited longer necks as a result, which statement is most likely to be helpful in correcting this students misconception?

a) characteristics acquired during an organisms life are generally not passed on through genes
b) spontaneous mutations can result in the appearance of new traits
c) only favorable adaptations of survival value
d) disuse of an organ may lead to its eventual disappearance

Answers

Answer: Characteristics acquired during an organism's life are generally not passed on through genes.

Explanation:

The most common misconception between students which can be corrected is that the characteristics acquired during an organisms life are generally not passed on through the genes. Thus, the correct option is A.

What are acquired traits?

Acquired traits or characteristics are the non-heritable changes in the function or structure of a living organism which is caused after birth and was absent before this. Occurrence of acquired traits could be due to disease, injury, accident, deliberate modification, variation, repeated use, or other environmental influence.

For example, the giraffe stretched its neck while reaching for the higher leaves but her children does not get a long neck by birth however this character has been fixed with time because of the repeated use of the neck for food.

Therefore, the correct option is A.

Learn more about Traits here:

https://brainly.com/question/24886772

#SPJ6

Explain how biotechnology has used the idea of ‘cut and paste’ when it comes to biotechnology *not multiple choice question*

Answers

Answer:

Biotechnology, the use of biology to solve problems and make useful products. The most prominent area of biotechnology is the production of therapeutic proteins and other drugs through genetic engineering. ˗ˏˋ ❤︎ ࿐

Explanation:

PRODUCT
OR
11. (Circle one) Oxygen is a
released?)
REACTANT
of respiration? (In other words, is it needed or

Answers

Answer: ?

Explanation:

How are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.

Answers

Answer:

I don't know

Explanation:

I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.

2 Both types of succession result in greater biodiversity over time.

3 Both types of succession decrease the stability of an ecosystem.

4 Both types of succession have the same starting conditions.

5 Both types of succession eventually lead to a community closer to equilibrium.

Hold on, our servers are swamped. Wait for your answer to fully load.

REPLY ASAP what's the main function of red blood cells, white blood cells, platelet and plasma?

Answers

Answer:

carries the blood components throughout the body

Explanation:

plasma is the largest part of your blood.

when are chromosomes (dna) copied?​

Answers

Answer:

Interphase begins with G1 (G stands for gap) phase. During this phase, the cell makes a variety of proteins that are needed for DNA replication. During S phase, which follows G1 phase, all of the chromosomes are replicated. Following replication, each chromosome now consists of two sister chromatids.

Have a good day. :)

Answer:

Chromosome replication

Explanation:

Chromosome replication is a key event during the cell cycle that must be completed before a cell divides. To reproduce successfully, every cell must replicate its chromosome and distinguish these sister chromosomes from one another.

Nondisjunction that occurs during meiosis II produces what?

Answers

Answer:

Both of these daughter cells will then go on to divide once more in meiosis II, producing 4 daughter cells, 2 with n+1 and 2 with n-1. Nondisjunction in meiosis II results from the failure of the sister chromatids to separate during anaphase II.

Is this person male or female? Why? :l

Answers

Answer:

I think Female because hey aren't any Y chromosomes

hope this helps

have a good day :)

Explanation:

PLEASE HELP I NEED HELP (Plant related / Project stuff)

Answers

Answer:

B, D, A, E, C

Explanation:

1. environmental factors

2. growth

3. adaptation

4. organism

5. genetic factors

Will this process below ensure with certainty that the offspring will retain their needles? Explain your answer.

Chastagner emphasizes that homeowners can minimize needle shedding by keeping their displayed trees well-supplied with water. In fact, when he has set up trees for research in early December and kept them watered, some species, like noble and Nordmann fir, have gone even three months with only minimal shedding.

Answers

Answer:

I'm in school I'll help you when get home around 4:30

When uncontrolled, the cell cycle becomes cancer. It forms lumps called..?

Answers

Answer:

Tumours are groups of abnormal cells that form lumps or growths. They can start in any one of the trillions of cells in our bodies.

Explanation: (:

Answer:

It forms lumps called tumors.

I don’t have a lot of time please help!
No websites or links.

Don’t answer it if you don’t now. Thanks

Answers

ANSWER: KR or Krypton has 36 protons

how we know that is because the atomic number of an element will ALWAYS be the same number of protons

for example if we have atomic number 79 for AU or gold then that tells you gold will have 79 protons

hope this makes since and helps :)

Help me please! Do 1,2,3 by filling in the blank!!!!

and no website

Answers

The answer is Glucose

how does rock turn into soil​

Answers

Erosion it breaks down the rocks into soil

Answer:

Rocks turn into soil through the process of weathering.

Explanation:

Weathering is when rocks are broken down into smaller pieces

c) Explain why wheat is not able to grow well in
nitrate poor soil.

Answers

Answer:

When soil available nitrogen is low, yield and protein content will be low. As nitrogen is applied beyond these levels the wheat plant will no longer use it to

Which of the following factors would make the smallest contribution to determining the climate of an ecosystem?


a.
precipitation patterns


b.
ocean currents


c.
geographic features such as mountain ranges


d.
magma under the earth's crust

Answers

Answer:

Latitude. ...

Elevation. ...

Ocean Currents. ...

Topography. ...

Vegetation. ...

Prevailing winds.

All of the animal and plant populations living in a particular area make up a ____.
A. population
B. community
C. habitat

Answers

Answer:

A) population

Explanation:

Answer:

A. population

Explanation:

for example, you may see the population of a town, right? different segments of nature make up what i like to call "wild life towns"

for example, on a map, you may see population of a certain species for square mile.

Someone’s help me please

Answers

Answer:

trailmix

Explanation:

Other Questions
Using table 3, predict the molecular geometry of the following molecules:a. The central atom bonded to four substituent atoms and having no lone pair.b. The central atom bonded to three substituent atoms and having one lone pair.c. The central atom bonded to two substituent atoms nd having one lone pair.d. The central atom bonded to two substituent atoms and having no lone pair. REAL answers PLSSS ASAP In an examination, 200 students out of 500, obtained first division. What percentage of student got first division Please Help! What decimal is less than 0.4? You want to purchase a new car in 3 years and expect the car to cost $30,000. Your bank offers a savings plan with a guaranteed APR of 5.5% if you make regular monthly deposits. How much should you deposit each month to end up with $30,000 in 3 years? What is the net force on the cart in the diagram?--> 50N --> 75N What is the total number of atoms in ammonium hydroxide?I will give Brainliest! :) Where should 3V49 be on the number line? If you are worried about location, parking and hours of operation, what factor of customer satisfaction is concerning you? value or time atmosphere or convenience? can someone explain this? (Civil war) give me a historical connection to the unit "He shall from time to time give to the Congress Information of the State of the Union, and recommend to their Consideration such Measures as he shall judge necessary and expedient; he may, on extraordinary Occasions, convene both Houses, or either of them, and in Case of Disagreement between them, with Respect to the Time of Adjournment, he may adjourn them to such Time as he shall think proper; he shall receive Ambassadors and other public Ministers; he shall take Care that the Laws be faithfully executed, and shall Commission all the Officers of the United States."9.What elected office is related to this passage from the Constitution?A. SenatorB. PresidentC. Speaker of the HouseD. Ambassador10.What is this passage from the Constitution describing?A. RolesB. QualificationsC. SovereigntyD. Powers take a very carefully look at the pictures below. write a brief paragraph of the photo using imagery, diction and figures of speech Point B: (14,4)Point A: (5,4)What is the difference between the x-coordinate of point A and the x-coordinate of point B? 12. Michelle and Amber were not always nice to their classmates. * simple compound complex How can you describe this photo?(In a paragraph) ANSWER RIGHT DO NOT EXPLAIN JUST HALP PWES PIC DOWN BELOW COJNHDHQ OK PLS TELL ME........whats it like?being in love?boys describe her as best as you can.girls describe himnon binarys describe them. tell me about them Should cereal be considered a soup?!? Steam Workshop Downloader