The function of red blood cells is _____________

Answers

Answer 1

Answer:

The primary function of red blood cells is to transport oxygen to body cells and deliver carbon dioxide to the lungs.

Explanation:

Answer 2

Answer:

Hi there! The answer is, The function of red blood cells is to transport oxygen (O2).

Explanation:

Blood cells carry a protein called hemoglobin at the top of their disc surface. This protein allows oxygen to bind to it and thus creates an oxygen rich surface that is then carried throughout the body.


Related Questions

Hibernation is an example  of A physical or structural adaptation .
True or false

Answers

False , only camouflage is a physical adaptation

Answer:

yea false

Explanation:


3. The diagram to the right shows a flower.
Which parts of the flower are male reproductive
structures?
A. parts A and B
B. parts C and D
C. parts E and F
D. parts D, E, and F

Answers

Answer:

A. parts A and B

Explanation:

A is the filament and B is the anther

What is the orgenlle that takes place in photosynthesis

Answers

Answer:

chloroplast

Explanation:

Drop a paper, a piece of thermopol, and a piece of plastic from a height of 10-15 feet. Note the time for each object to hit the ground. Why does the paper take more time than thermopol and thermopol more than the plastic piece? Make the paper to fell down in such a way that it should hit the ground before all of them. How did it happen? Explain.

Answers

It took the paper longer because is has a lot of surface area that air can resist to and push up, making it float slowly to the floor rather then drop quickly. The piece of plastic is also more aerodynamic than the piece of paper because the air wont have as much surface area to resist to.

We folded it into a paper airplane. We did this so that it will be more aerodynamic.

Correct me if I’m wrong.



It took the paper longer as it has quite a few surface places that air can withstand and push up, making it glide slowly to the ground rather than drop fast. The piece of plastic is likewise extra aerodynamic than the piece of paper because the air won't have as an awful lot of floor regions to face up to.

What is aerodynamic in simple terms?

Aerodynamics is the way air actions around matters. The guidelines of aerodynamics give an explanation for how an aircraft is capable of fly. whatever that movements through air reacts to aerodynamics. A rocket blasting off the launch pad and a kite within the sky react to aerodynamics. Aerodynamics even acts on vehicles, considering that air flows around motors.

What is an aerodynamic example?

Aerodynamics is the way air moves around matters. given that air is all around us, there are many examples of aerodynamic technology other than for aircraft. take a look at golf balls for instance. golfing balls have their unique shape with loads of dimples on them to improve their aerodynamics and create more lift.

Learn more about Aerodynamics at https://brainly.com/question/4702501

#SPJ2

when a chicken with black feathers mates with a chicken with white feathers, their offspring may be a speckled hen. Half of a speckled hen's feathers are black and the other half are white. This is an example of:

A. multiple alleles

B. simple dominance

C. Codominance

D. incomplete dominance

Answers

i’m pretty sure it’s C. Codominance

Answer:

codominance

Explanation:

Will give brainliest to whoever gets it right at the end of my exam :))

Answers

Answer:

#3

Explanation:

What happens when an organism is eaten? A. All of its energy is returned to producers. B. All of its energy is gone when it dies and cannot be reclaimed by the ecosystem. C. A small portion of its energy is absorbed by the consumer, the rest is transformed into heat or waste. D. All of its energy is absorbed by the consumer.

Answers

Answer:

The higher organisms eat the lower organisms, break down their matter and rearrange the molecules to make their own matter. When any organism dies, the remains are broken down and put back into the cycle as inorganic molecules. Each of these organisms eat organic matter to produce energy and small pieces of matter.

Location X is next to Location Y and they are both much colder than Location Z. Which statement is most likely true? a Locations X and Z are at the poles. b Locations X and Y are at the poles. c Locations X and Z are at the equator. d Locations X and Y are at the equator. WILL MARK BRAINLIEST

Answers

B locations X and Y are at the poles

Which pair of objects has the largest gravitational force?
a- car and bowling ball
b- marble and baseball
c- There is no gravitational force between any of these pairs of objects.
d-marble and can

Answers

Answer:a

Explanation: they are bigger they take up more space and heavier so the pull of gravity is stronger because of that

Why does oxygen from our lungs diffuse into the bloodstream?

Answers

Answer:

so we can breath duh

Explanation:

In this diagram below , which of the stomach tissues would be muscular tissues ?


- tissue 1 : forms the outer lining of the stomach


-tissue 2 : produces enzymes which are secreted into the stomach cavity


- tissue 3 : cells in this tissue contract to churn the contents of the stomach


In a numeric number

Answers

Tissue 1 which forms the outer lining of the stomach would be the muscular tissues.

What is Muscularis mucosa?

This is referred to as the outermost layer of the mucosa and comprises of elastic fibers and smooth muscle cells.

The muscular tissue is therefore tissue 1 as a result of its location and function in the body.

Read more about Muscular tissues here https://brainly.com/question/2648088

#SPJ1  

Place the answer below for the Deck Toys completion (two words)
If you do K12, you might know this

Answers

Answer:

What are the word options?

Explanation:

Pea plants can have alleles for being tall or for being short. A pea plant has one allele for being tall, and one allele for being short. When it grows, it ends up being a tall plant.

because of this what do we know is true about pea plant alleles?

A. being short is a dominant allele

B. All pea plants must be short

C. All pea plants must be
tall

D. Being tall as the dominant allele

Answers

Answer:

D

Explanation:

the dominant traits tends to be the one shown

What is the carrying capacity (approx)?

Answers

Answer:

ecological terms, carrying capacity is defined as the maximum number of a species that can sustainably live in a given area.

What is the function of epithelial cells?

Answers

Answer:

Pretty much everything that goes on inside ur body

Explanation:

Epithelial tissues are widespread throughout the body. They form the covering of all body surfaces, line body cavities and hollow organs, and are the major tissue in glands. They perform a variety of functions that include protection, secretion, absorption, excretion, filtration, diffusion, and sensory reception.

can anyone help me with this question? whoever answers first gets brainliest!

Answers

Answer:

A is the most likely

Explanation:

1. Blood flowing through the aorta is distributed to all parts of
the body, except the:
A. lungs.
B. small intestine.
C. heart.
D. brain.​

Answers

Answer:

I think d . brain must be the ans

Why are cells so small?

Answers

Answer:

Why are cells small? because they can absorb nutrients much more efficiently. Because they are smaller they can efficiently absorb enough food. When a cell doubles in size the volume increases much more then the surface area, which is why large cells cannot receive enough food efficiently for their volume.

Hope this helped :)

what is the name of the process where plants water from their leaves?

Answers

Answer:

Transpiration

Explanation:

Transpiration That’s that

What roles do humans play in the carbon cycle?

Answers

Answer:

Humans affect the carbon cycle by burning fossil fuels and cutting down trees. Car exhausts and factory emissions produce a lot more CO2 in the atmosphere!

Explanation:

HOPE THIS HELPS:)

What are some common characteristics that infectious agents like viruses, bacteria, fungi and parasites have in common? What are some differences?

Answers

Bacteria. These one-cell organisms are responsible for illnesses such as strep throat, urinary tract infections and tuberculosis. Viruses. Even smaller than bacteria, viruses cause a multitude of diseases ranging from the common cold to AIDS. (Here is some that I found.)

Who coined the word 'antibiotic'?

Answers

Answer:

Selman Waksman, the microbiologist who discovered streptomycin, first used the word "antibiotic" in the medical sense in 1943. Science historian Howard Markel talks about how it was actually a naval officer who first coined "antibiotic" in 1860, to describe an opposition to the belief in life beyond Earth.

URGENT! HIGH POINTS
Match the following. Each word should be used only one time.
Colossians, deductive, defined, inductive, observations, Romans.


Science deals with __________________ of the physical world.

___________________ reasoning is the process of applying a rule.

___________________ reasoning starts with facts and works toward general conclusions. It is the process of finding a rule.

The statement “2+2=4” can be classified as a _________________ truth.

Christians should try hard to understand science, so that they are not deceived by hollow and deceptive philosophies (__________________ 2:8)

We can improve our relationship with God by studying His creation (____________1:20).

Answers

Answer:

A  Observations  B Deductive  C Inductive  D: Defined  E Colossians  F Romans

Explanation:

What does metabolically inert mean? "Sucrose is soluble but metabolically inert"

Answers

Metabolik olarak inert ne anlama geliyor? "Sakkaroz çözünür ancak metabolik olarak etkisizdir"
Derslerinde başarılar dilerim

Viruses are metabolically inert and incapable of reproducing independently of a host cell (hence are non-living).

What is meant by metabolically inert?Viruses are metabolically inert and incapable of reproducing independently of a host cell (hence are non-living). They typically consist of an inner core of nucleic acid surrounded by a protein coat (capsid). Simpler viruses may lack a capsid (viroids), whilst more complex viruses may possess an external lipid envelope.

Viruses are metabolically inert and incapable of reproducing independently of a host cell (hence are non-living).

To learn more about metabolically inert refer:https://brainly.com/question/1229016

#SPJ2

Which phrase is appropriate for an advertisement for a health service?
"new discovery"
"FDA-approved''
"amazing results"
"European"

Answers

The answer would be amazing results

Answer:it’s FDA-approved

Explanation:

Don’t do amazing results it’s wrong I took the test

NEED HELP VERY SIMPLE WILL MARK BRAINLIEST THANKS

Answers

Answer:

The organism

Explanation:

Answer:

last one and the second

Explanation:

If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?

Answers

UACCGCUCCGCCGCUCGACAAUACC

what properties of carbon explain carban's ability to form different large and complex structure?​

Answers

Sick icijdnxn I. N I I j. Snap

What are 2 things to all cells have?

Answers

Answer:

All cells have CYTOPLASM and DNA.

Explanation:

my answer got deleted.

PLEASE HELP ME NOW!!!!!!!!!!!
(02.03 HC)
Examine the layers of rock. Identify and explain which layer contains the youngest fossils. (3 points)

Answers

Answer:

A

Explanation: A is the youngest bestie <3333

Answer:

A

Explanation:

Because it is at the top

Other Questions
PLEASE HELP!!!!!!!!!!!!!!!!!! 5. Genevieve was obsessed with details. She felt that everything that she submitted to her teacher had tobe perfect. For the final project in reading class, students were given one week to use their art skills tobring a scene from a novel to life. Genevieve decided that she would build a shoebox diorama. She spentthe first two nights creating an intricately detailed scene far superior to anything that her classmates wouldproduce, but she ended up throwing it away because she didn't like how tape was visible at the bottom ofthe diorama. The next two nights she worked on a similar diorama, but this time she used glue. Again,Genevieve produced a beautiful product, but she was troubled by how the glue looked when it dried, soshe discarded her work again. Over the weekend and into the next week, Genevieve recreated the projecta third time. This time she used a special adhesive putty to construct the diorama and was completelysatisfied with the appearance. Unfortunately, her project was now several days late and her grade on theassignment was lowered to a C.What is the theme of the story? which answer choice contains dialogue When is the President most likely to use an executive order to make importan policy 1.Given that the input A is true and the input B is false, what is the resulting value ofthe output?a. Trueb. False Pls help due at midnight Matt Ali deposited $25,000 in a savings account. The account earns 5.5 percent interest compounded daily. Use the formula Amount of $1.00 at 5.5 Percent compounded Daily. A). What amount will he have in his account 28 later ? B.) How much will be compound interest ? The perimeter of the triangle shown below is 37 centimeters. Find the value of x.2r + 13x2(x + 4) IGIVEEEEEEEEEEEEEEEEEEEEE BRSAINLILSTER I NEED HELP LIKE FOR EXAMPLE BLUE CHRISTMAS U KNOW PLEASE HELP DUE TOMORROW why was the renaissance the home of the renaissance? i dont understand this question at all, but please help :))) 3.1(g-7)-1=5.2 what is G Find the value of 9u - 6 given that -2u+2=6 Diffusion welding in Ti6Al4V to Ti6Al6V2Sn Find the distance between the points (8,-3) and (2, -3). Under what condition could a person have a lot of wealth but little income?A. If the person has more money than propertyB. If the person has inherited money and does not workC. If the person has more debts than he or she can pay backD. If the person has an income that matches the amount he or shehas inherited Research online about health care in Guatemala. Write a paragraph in Spanish about what you've learned about the Guatemalan health care system. Include the following points in your response: Guatemalans' opinions about their own healthcare system quality of Guatemalan healthcare comparisons between health care in the United States and health care in Guatemala positive aspects about the Guatemalan healthcare system The coordinates of point L on a coordinate grid are (2, 4). Point L is reflected across the y-axis to obtain point M and across the x-axis to obtain point N. What are the coordinates of points M and N? How many original copies of the bills of rights exits13141512 If Jo drives 357 miles and uses 17 gallons of gas how many miles per gallon did he get? How far could Jo go on 50 gallons of gas? Steam Workshop Downloader