PLEASE HELP ASAP WILL GIVE BRAINLEAST TO CORRECT ANSWER

PLEASE HELP ASAP WILL GIVE BRAINLEAST TO CORRECT ANSWER

Answers

Answer 1

Answer:

B Increase: 1, 6

B Decrease: 2, 5

Step-by-step explanation:

Brainliest plz ;)


Related Questions

Between which 2 consecutive integers is each number located on a number line?


__ < .99 < __

Answers

Answer:

x lies between 0 and 1 on the number line

Step-by-step explanation:

As we move to the left from 0.99, the first integer we reach is 0; as we move to the right from 0.99, the first integer we reach is 1.

Thus, 0 < x > 1:  x lies between 0 and 1 on the number line.

Plzzzzzzzzzzzzz help ;-;

Answers

Answer:

option A

associative property of addition

Answer:

Associative property

Step-by-step explanation: when they are added or multiplied does not change the sum or product

Could someone please me find this answer

Answers

Answer:

9/100

Step-by-step explanation:

a percent is 9 out of 100 so it is 9/100

The lenght of a turtles shell z, in millimeters, is related to the turtles age in years a , as described by the equation below.
s=55a+37
Which statements about the turtle are true?
Select 3

Answers

Answer:

B, C , F

Step-by-step explanation:

The age multiplied 55, so the shell grows at rate of 55mm per year

in fact if the age is 2 we have (55 x 2) = 55 + 55

if 3 = (55 x 3) = 55 + 55 + 55

and so on

When the turtle is hatched the shell is 37 mm in lenght.

In fact, if we substitute 0 to a, we have

s = (55 x 0) + 37

s = 37

when the turtle is 1 year old, the shell is 92 mm in length.

in fact if we substitu a with 1, we have

s = (55 x 1) + 37

s = 55 + 37

s = 92

Which one because it hard am going to keep telling questions

Answers

Answer:

56

Step-by-step explanation:

If f(x) =- 2x + 5, find f(4x)​

Answers

Answer:

[tex]f(4x)=-8x+5[/tex]

Step-by-step explanation:

We are given the function:

[tex]f(x)=-2x+5[/tex]

And we want to find:

[tex]f(4x)[/tex]

So, by substitution, we acquire:

[tex]f(4x)=-2(4x)+5[/tex]

Multiply. So, our answer is:

[tex]f(4x)=-8x+5[/tex]

Write 142 as a fraction or mixed number

Answers

Answer: 142/1

Step-by-step explanation:

Answer:

1.42 or 71/50

Step-by-step explanation:

In order to get the answer just divide.

71÷60=1.42

Answered by the ONE & ONLY #QUEEN herself aka #$$$DRIPPQUEENMO!!

I HOPE THIS HELPED!!!

can any one help me i really need it

Answers

34 try the app Cymath it’s great for math

Answer:

i got 722.5, Not sure if this is right but it's what I got

HELP I MARK BRAIN thing

Answers

Answer:

It would be A. x < 6

Step-by-step explanation:

The number line shows it is less than six with a closed circle and the arrow pointing towards the left of it


PLEASE HELP !
Determine whether each equation represents a linear or a nonlinear function
Select Linear or Nonlinear for each equation

Answers

Step-by-step explanation:

Note:

Linear equations will never exponents in its equation such as

[tex] {x}^{2} \\ y = {x}^{3} [/tex]

as those equations will produce curly graphs.

Nonlinear equations will either contain exponents or logarithms (eg. ln2)

Bank account C starts with $10 and doubles each week. Bank account D starts with $1,000 and grows by $500 each week.

When will account C contain more money than account D? Write an equation to represent the situation and solve.

Your help is much appreciated.

Answers

Answer:it will take bank d 8 weeks to get more than bank c

Step-by-step explanation: 10 20 40 80 160 320 640 1280 2560 5120 10240

the circumference is about ___ mm.

use 3.14 fir pi​

Answers

Answer:

C =62.8 mm

Step-by-step explanation:

The circumference of a circle is given by

C = 2 * pi *r

C = 2 * 3.14* 10

C =62.8 mm

Place the quadratic y=2x^2+24x+79 into vertex form by using the method of completing the square and then state the coordinates of its vertex.

Answers

Answer:

[tex]y=2(x+6)^2+7[/tex]

[tex](-6,7)[/tex]

Step-by-step explanation:

[tex]y=2x^2+24x+79[/tex]

Completing the square is a process of converting a quadratic equation in standard form into vertex form.

The first step in completing the square is grouping the quadratic and linear terms of the quadratic equation.

[tex]y=(2x^2+24x)+79[/tex]

Factor out the coefficient of the quadratic term,

[tex]y=2(x^2+12x)+79[/tex]

Now complete the square, add a term to make the grouped part of the equation a complete square, then balance the equation.

[tex]y=2(x^2+12x+36-36)+79[/tex]

Simplify,

[tex]y=2(x^2+12x+36)+79+(2)(-36)[/tex]

[tex]y=2(x+6)^2+79-72[/tex]

[tex]y=2(x+6)^2+7[/tex]

The x-coordinate of the vertex of the equation is equal to (-1) times the numerical part of the quadratic term, and the y-coordinate is equal to the constant.

[tex](-6,7)[/tex]

find the two consecutive whole numbers of 97

Answers

Answer:

48 and 49

Step-by-step explanation:

48 + 49 = 97. Therefore the 2 numbers are 48 and 49

Solve the following system of equations show all your work. Write the solution as a point (x,y) (4 points).
3x + 5y = -40
–x + 4y = -15?

Answers

Answer:

-5,-5

Step-by-step explanation:

m a  t  h  w  a  y  .  c  o  m

The ratio of melanie's allowance to jacob's allowance is 4.1 to 20.5. If Jacob gets $5.00,how much allowance does melanie get?

Answers

Answer:

1.00

Step-by-step explanation:

x=(5*4.1)20.5

x=1

Each figure below is a regular polygon and has radii and apothem shown. The find measure of each numbered angle.
161
Column A
Column B
1.
m24
a. 67.5°
2.
m25
b. 22.5°
3.
m26
C. 45°

Answers

Cand A I thinkkk lol

Marta’s math textbook weighs Four-fifths of a pound less than 4 times the weight of the book she is reading for her language arts class. If the weight of the math textbook is 2 and one-fifth pounds, which shows the correct equation and value of x, the weight of Marta’s book for language arts?
4 x + four-fifths = 2 and one-fifth; x = StartFraction 7 over 20 EndFraction of a pound
4 x minus four-fifths = 2 and one-fifth; x = three-fourths of a pound
4 x + four-fifths = 2 and one-fifth; x = three-fourths of a pound
4 x minus four-fifths = 2 and one-fifth; x = StartFraction 7 over 20 EndFraction of a pound

Answers

Answer:

C

Step-by-step explanation:

Use the recursive relationship to complete the next two rows of Pascal's triangle. Row 5: 1 _ _ _ _ 1 Row 6: 1 _ _ _ _ _ 1

Answers

Answer:

      1   5  10  10   5   1           Row 5

   1   6   15  20  15   6    1       Row 6

Recursive relationship:

Each row has number of positions = row number + 1. The Row 0 is always 1.

The first and last number in each row is 1, the number in the second position and the penultimate corresponds to the number of the row.  The middle numbers correspond to the sum of the two numbers in the top row. The resulting number from the addition is located in the middle of the numbers added in the next row.

Step-by-step explanation:

The pascal's triangle

* Row 0  =  1

* Row 1 = 1  1

                   1                          Row 0

                1    1                       Row 1

Since there are only two positions, the first and last are 1.

*Row 2 = 1  _ 1

                   1                          Row 0

                1    1                       Row 1

              1   2   1                     Row 2

2 is the sum of 1 + 1 and we place it in the next row between the added numbers 1 and 1.

* Row 3 = 1 _  _    1

                  1                          Row 0

                1    1                       Row 1

              1   2  1                    Row 2

            1   3   3  1                   Row 3

1 + 2 = 3  (the row number and the and adding the numbers from the previous row)

* Row 4 = 1 _  _    _   1

                  1                          Row 0

                1    1                       Row 1

              1   2   1                     Row 2

            1   3  3  1                   Row 3

         1   4   6   4   1                Row 4

1 + 3 = 4  (the row number)

3 +3 = 6

* Row 5 = 1 _  _   _  _   1

                  1                          Row 0

                1    1                       Row 1

              1   2   1                     Row 2

            1   3   3  1                   Row 3

         1   4   6  4   1                Row 4

     1   5   10   10   5   1           Row 5

1 + 4 = 5

4 + 6 = 10

* Row 6 = 1  _  _ _  _  _   1

                  1                          Row 0

                1    1                       Row 1

              1   2   1                     Row 2

            1   3   3  1                   Row 3

         1   4   6   4   1                Row 4

     1   5   10 10  5   1           Row 5

   1   6   15  20  15   6   1        Row 6

1 + 5 = 6

5 + 10 = 15

10 + 10 = 20

Helpp
A group of 8 students was asked, "How many hours did you watch television last week?" Here are their responses:
15, 14, 6, 13, 20, 13, 9, 17

Answers

17 that’s the answer I did this one before

Mhanifa can you please help? I will mark brainliest!

Answers

Answer:

Given function

h(x) = 2x - 1

#15 Find the inverse of h(x)

Substitute x with y and h(x) with x and solve for y:

x = 2y - 12y = x + 1y = 1/2x + 1/2

The inverse is:

h⁻¹(x) = 1/2x + 1/2

#16 The graph with both lines is attached.

The x- and y-intercepts of both functions have reversed values.

#17 Table of the inverse function  will contain same numbers with swapped domain and range.

Initial look is like this:

x        |  -3  |  -2  | -1  |  0  |    1  |  2  | 3h⁻¹(x)  |  -1   |       | 0   |      |    1  |      | 2

The rest of the table is filled in by finding the values:

x        |  -3  |  -2    | -1  |  0   |  1  |  2   | 3h⁻¹(x)  |  -1   | -0.5 |  0  | 0.5 |  1  | 1.5 | 2

HI! please help out ASAP this is due today! Explain it the best you can and send a picture explaining it so I won’t get confused. Thank u!

Answers

points are

(0,-1)
(3,-2)
(1,-4)

In California, the sales tax is 9.25%. In Oregon, there is no sales tax. How much does an Oregon resident save versus a California resident when buying a $20,000 new car? (Section 13.2) (2 points)

Answers

Answer:

use this https://www.calculator.net/sales-tax-calculator.html

Step-by-step explanation:

Please I need help ASAP 40. Points

Answers

Total owed = starting amount x( 1 + interest rate) ^ time

The equation would be total = 550(1.12)^x where x is the number of months.

Replace total with 550x2 = 1100 and solve for x

It will double in 6.11 months. Round to 6 months



Use the ALEKS calculator to write as a percentage.
5/17
Round your answer to the nearest tenth of a percent.

Answers

Answer:

The answer is 29.4%

Step-by-step explanation:

The given is to be rounded to the nearest tenth percent so

5/17 = 0.294

0.294 * 100 = 29.4% since nearest tenth percent

The required answer is 29.4%

Given fraction is 5/17.

Percentage is a way of expressing a fraction or proportion as a portion of 100. It is a mathematical concept used to represent relative quantities or values in terms of hundredths. The word "percent" is derived from the Latin words "per centum," which mean "per hundred." It is denoted by the symbol "%".

To convert a fraction to a percentage, and multiply the fraction by 100.

Let a and b be the rel numbers. To convert the fraction a/b into percentage by multiply the fraction by 100.

That is , a/b x 100.

And on simplification gives the fractions.

To convert 5/17 to a percentage, we have:

(5/17) x 100 = 29.4117647...

Rounding this to the nearest tenth of a percent, we get:

29.4%

Therefore, when rounded to the nearest tenth of a percent, 5/17 is approximately 29.4%.

Learn more about converting fractions to percentages, click here:

https://brainly.com/question/25395

#SPJ6

Which is an equation of the line through the origin and (-8, -5)?
O A. y = 8/5 x

O B. y= -5x

O C. y = 5/8x

D. y = -8x



Help
Plz due now

Answers

Answer C - y=5/8x since slope is rise/run
the answer is C. y= 5/8x

What percent of 12 is 9?
A. 25%
B. 67%
C. 75%
D. 108%
E. 133%

Answers

Answer:

75%

Step-by-step explanation:

75% = 3/4

3/4 * 12 = 9

i need help with this​

Answers

Answer:

A) 9 inches per minute

Step-by-step explanation:

36 inches in 4 minutes

36/4 = 9 inches per minute

7x+3y=11
3x-y=23
Solve by substitution

Answers

hope this helps have a nice day :)

WORTH 25. Help me please. I don't ask that much I'm not begging you either. Thanks.

Answers

Answer:

9.

Step-by-step explanation:

It's further away from the other numbers by a significant amount.

Other Questions
need explanation with these problems! help me please! Sort the cultural values and beliefs about women into the appropriate categories. Decide whether each was commonbefore or after changes in the late 1800s. Pls help. I will give you 10 points! Can somebody help me asap pls help me i will give 30 points help me pls don't type random letter or I will report u ty 1. Vamos a hacer un picnic en el parque hoy.A. lllgicoB. Lgico2. El primer da del ao es un da festivo, pero ese da casi todo el mundo est cansado! A. lllgicoB. Lgico3. La familia de Migdalia es enorme. Tiene parientes en casi todo el Mxico.A. lllgicoB. Lgico4. El beb de Sofa cumpli ayer 29 aos. Es muy simptico! A. lllgicoB. Lgico5. Muchos bebs tienen la costumbre de llorar cuando tienen hambre.A. lllgicoB. Lgico6. Qu desastre! Ayer fue el cumpleaos de Julio Andrs y se me olvid felicitarlo!A. lllgicoB. Lgico7. Una persona educada es una persona que no tiene buenos modales. A. lllgicoB. Lgico8. La fiesta de sorpresa para la Srta. Gutirrez fue excelente. Ella nos ayud a prepararla!A. lllgicoB. Lgico9. La abuelita de mi amiga Idalia naci hace dos das.A. lllgicoB. Lgico10. Alrededor del museo haba estatuas antiguas y modernasA. lllgicoB. LgicoHelp please Suzie looked at the diagram at right and wrote 134%=134/200. Is she correct? It is important to consider the social, emotional, physical, and economic effects of teen pregnancy on the teen parent, the child, the family, and society. Think about your goals for the future and how they could be affected by teen pregnancy. Use this decision-making process document to help brainstorm your ideas and organize your thoughts. Then respond to the prompt. the half-life of roentgenium -281 is 17 seconds,if 10 grams are left after 85 seconds,how many grams were initially in the original sample? Find the midpoint of the line segment with endpoints (-3, 2) and (1.-2)A)(-1,0)B)(0, -1)(-2,0)D)(0, -2) The radius of a circle is 11 millimeters. What is the circle's circumference? Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG The Know-Nothing Party opposed which of the following? 1) What is your Dawn Wall and how are you approaching it? What is the expected outcome? (Or, reflect on a 'Dawn Wall' in your past and discuss how you overcame it.)2) Describe a few things that Kevin and Tommy had to overcome to realize their goal. (Or, describe what things had to be in order or exist for their goal to be realized.) Which of the following ions is formed when a base is dissolved in a solution? H+ O OH SO42+ 1) What percentage of oxygen and carbondioxide inhaled and Exhaled Air ? .. A. Suriin kung anong panghalip panao na ginagamit sa pangungusap.1. Sila ay magsisimba.2. Hiniwa niya ang tiyan ng manok.3. Ako ay mag-aaral sa Tiptip ng Elementarya.4. Ikaw ay kasama ko. why is this wrong and what is the right answer? Which statement describes Keplers third law of orbital motion? Steam Workshop Downloader