Help I'm not good at this :))

Help I'm Not Good At This :))

Answers

Answer 1

Step-by-step explanation:

1 yes it is rational

2 not

3yes

4 not

5 yes


Related Questions

(14+y)+3 please im stuck on this question

Answers

Answer: Just add the 14+3

= Y17

Step-by-step explanation:

What is the standard form for 10 to the power of -9

Answers

Answer:

is there any whole number or decimal

Do you think the difference of 1.4-0.95 is less than one or greater than one? Explain.

Answers

Answer:

The answer would be , less than one .

The difference of 1.4 - 0.95 is less than one as per the concept of subtraction.

To determine this, we can simply subtract the two values:

1.4 - 0.95 = 0.45

Since the result of the subtraction is 0.45, which is less than one, we can conclude that the difference of 1.4 - 0.95 is indeed less than one.

In numerical terms, the difference is 0.45, which is 45 hundredths or less than half of one whole unit.

When comparing the two original values, 0.95 is almost half of 1.4, making the difference smaller than one.

In summary, the difference of 1.4 - 0.95 is less than one, specifically 0.45. It is essential to pay attention to the decimal values and their magnitudes when determining the difference between two numbers.

To learn more about subtraction;

https://brainly.com/question/2346316

#SPJ3


help! will mark branliest

Answers

Answer:

B is the answer hope you get it right

5y x 6y= you can get 40 points

Answers

Answer:

5y × 6y = 30y^2

Step-by-step explanation:

All you're doing is multiplying the coefficients 5 and 6, to get 30, and any variable multiplied by another variable will give you that variable, squared.

Friendly fun fact: When you give points, we are only earning half of that. (Just thought you'd like to know.)

Hope this helped :)

Estimate 53.8-27.6. circle the compatible numbers to substitute


54-28 53-28 55-27 55-25

Answers

Answer:

54 - 28

Hope this helps :)

The compatible numbers to substitute is 54 - 28

How to determine the compatible numbers to substitute

From the question, we have the following parameters that can be used in our computation:

Estimate 53.8 - 27.6

This means that we approximate the numbers in the expression

using the above as a guide, we have the following:

53.8 = 54

27.6 = 28

Hence, the compatible numbers to substitute is 54 - 28

Read more about expressions at

https://brainly.com/question/30492964


#SPJ3

bc if b = -3 1/8 and c = -4/5

Answers

Answer:

-3 37/40

Step-by-step explanation:

is the sum of 0.46+0.25 less than or greater than one? explain

Answers

Answer:

0.71

Less than one

Step-by-step explanation:

For the number to be more than one, the tenth would have to equal more than ten. For the hundredth, it would have to be more than 100.

-kiniwih426

0.71

Less than one because you look at the digits in the tenths/ one hundreds place.

Simone works at an assembly plant she made 490 items in five days how many items did she average per day?

Answers

Answer:

98 per day

Step-by-step explanation:

490 / 5

= 98

Devin owes $26,000 in students loans for college. The interest rate is 8.75% and the loan will be paid off over 15 years. How much will Devin pay altogether?

Answers

Using simple interest, it is found that Devin will pay $60,125 altogether.

The amount paid in simple interest is:

[tex]A = P(1 + rt)[/tex]

In which:

P is the principal.r is the interest rate, as a decimal.t is the time, in years.

In this problem:

Owes $26,000 in student loans, thus [tex]P = 26000[/tex]Interest rate of 8.75%, thus [tex]r = 0.0875[/tex]Paid off in 15 years, thus [tex]t = 15[/tex].

The amount he will pay is of:

[tex]A = P(1 + rt)[/tex]

[tex]A = 26000[1 + 0.0875(15)][/tex]

[tex]A = 60125[/tex]

Devin will pay $60,125 altogether.

A similar problem is given at https://brainly.com/question/13176347

Given
mZLON = 77°
mZLOM = 9x + 44°
mZMON = 6x + 3°
Find mZMON:

Answers

Answer:

FVRF

Step-by-step explanation:

m is the midpoint of AB has coordinates (5, -4), if A has coordinates (6, 1). What are the coordinates of B?

Answers

Answer: (4,9)

Step-by-step explanation: We assume a straight line, so y=mx+b.

We can determine slope, m: Change in x is (6-5)=1. Change in y is (1-(-4)) = 5 Slope is (Change in y)/(Change in x) = 5/1, or 5

y=5x+b

Find b for (6,1)

1 = 5*6 + b

b = -29

y = 5x-29

Since A is (6,1) and m is (5,-4) we can calculate y for x=4 (point B)

y = 5(4)-29

y = -9

B is (4,-9)

is this graph skewed or roughly symmetrical?​

Answers

Answer: Roughly Symmetrical

Step-by-step explanation: There's no super easy way to explain why other than learning with experience but if you look at about the center of the graph, there are two peaks, and each side of the graph if split at about 68 which is the center, has 7 points each. This in conjunction with the shape and relatively normal spread makes it roughly symmetrical, not quire symmetrical but getting there.

Find the area of each triangle

Answers

Answer:

a.20,b.31.5

Step-by-step explanation:

h x b then Divide by 2

Translate this sentence into an equation.
63 is the sum of 15 and Gail's score.
Use the variable g to represent Gail's score.

Answers

Answer:

63 = 15 + g

Step-by-step explanation:

63 is the sum of 15 and Gail's score:

63 = 15 + g

Find a compatible dividend for the division problem.
2,394

Answers

The numbers that 2394 is divisible by are 1, 2, 3, 6, 7, 9, 14, 18, 19, 21, 38, 42, 57, 63, 114, 126, 133, 171, 266, 342, 399, 798, 1197, and 2394

What is the probability

Answers

The answer is yes but not if so

PLEASE I NEED HELP RIGHT NOW!!!

The altitude of an airplane is decreasing at a rate of 44 feet per second. What is the change in altitude of the airplane over a period of 37 seconds?

A. -1,628 feet
B. 81 feet
C. -81 feet
D. 1,628 feet​

Answers

Answer:

1628

Step-by-step explanation:

Answer:

Either A or D. But I'd vote on A. Hope this helps! :)

Step-by-step explanation:

PLS MARK BRAINLEST!!!

(5k-10)•-9
show work plssss

Answers

I’m not a 100% sure but I think it’s -45k+90 I think that’s a answer I can’t show no work srry

Find the missing length indicated

Answers

Step-by-step explanation:

10)

again, drawing the height into a right triangle creates 3 right triangles : the original one, and the 2 on both sides of the height.

all these 3 triangles are similar to each other (the angles must be the same).

therefore the ratio of 2 sides in one triangle must be the same as the ratio of the corresponding 2 sides in the other triangles.

so,

x/36 = 64/x

x² = 64×36

x = sqrt(64×36) = 8×6 = 48

11)

same principle.

x/36 = 100/x

x² = 100×36

x = sqrt(100×36) = 10×6 = 60

12)

same as 11)

x/9 = (16+9)/x = 25/x

x² = 25×9

x = sqrt(25×9) = 5×3 = 15

What is the slope of the line 2y = -8x + 10? =​

Answers

Answer:

[tex]2y = - 8x + 10 ) \div 2\\ y = - 4x + 5 \\ m = - 4 = slope[/tex]

Answer:

the slope is -4x

Step-by-step explanation:

2y=-8x +10

/2    /2

y=-4x+5

If the code for BEAD is DGCF, what is the code for SHARP?

Answers

Answer:

UJCTR

Go up to from the current letter to get the answer i think?

You can try finding the pattern behind the conversion.

The code for SHARP is UJCTR

How to find the pattern behind code conversion?

Well it depends. There are infinite possibilities.

Most of the times, if its like a question from some exam or book etc, then there is certain simple pattern which you can see if focus. Otherwise, there may be too complex, or sometimes too simple, or sometimes moderately complex patterns.

For given case, you can see that the pattern is to take the third letter from the given letter from the English alphabet.

For B it was B - C - D, thus, D

For E it was E - F - G, thus, G

For A it was A - B - C, thus, C

For D it was D - E - F, thus, F

Similarly, we get:

For S it was S - T - U, thus, U

For H it was H - I - J, thus, J

For A it was A - B - C, thus, C

For R it was R - S - T, thus, T

For P it was P - Q - R, thus, R

Thus,

The code for SHARP is UJCTR

Learn more about character coding here:

https://brainly.com/question/17120657

A fair coin has a probability 0.5 of coming up heads. If you toss a fair coin twice, are you certain to get one head and one tail?

Answers

Answer:

no you cant be certain but you can.

Step-by-step explanation:

Find the intersection point of the straight line equations y = 2x-13 and y = -5x+1​

Answers

Answer:

(2,-9)

Step-by-step explanation:

Equation Form:

x = 2  

y = − 9

Fred's family wants to switch cell phone plans. Hot Spot Mobile is offering a one-time discount of $50 for families that use multiple phones with their service. Fred's family uses 5 phones, and the salesperson said the first month's payment, which includes the discount and the regular monthly rate for each phone, will be $62.25. What is the regular monthly rate for each phone?

Answers

The regular monthly rate for each phone is $22.45.

What is a monthly rate?

The monthly rate refers to the amount of money paid every month due to a service or debt.

How to calculate the monthly rate for these cellphones?

The monthly rate can be calculated using the following formula.

$62.25 + $50 (discount) / 5 (number of cellphones)

This is because the family will pay a total of $62.25 for the 5 cellphones including the discount for the first month. Let's now solve this problem:

$112.25/5 = $22.45

Learn more about money in: https://brainly.com/question/2696748

1:50000
What distance is represented by Tem?
18cm
D
E
6.25cm
X
B
8cm
Jane Nane serigre ines
OP para
с
Net Groen
6cm
P
a
M
A
Som
N
Gom
15cm

Answers

Answer:

explain better

Step-by-step explanation:

I do not understand

It is 8383838

Use the zeros and the labeled point to write the quadratic function
represented by the graph.
у
Х
-5
5
(3-6)
- 10

Answers

Answer:

y = 2x2 - 10x + 12

Step-by-step explanation:

The quadratic function represented by the graph is y= 2x² - 10x + 12.

What is the quadratic function represented by the graph?

The task's requirements dictate that the quadratic function represented by the graph be identified.

As the roots of the quadratic function are p and q, the quadratic function can be described as y = a (x - p) (x - q), where a is a constant.

As a result, since the roots are 2 and 3, we obtain;

y = a (x - 2) (x -3) (x -3)

So, we must substitute the values defined by the provided point, (1, 4), as shown below in order to find the value of the constant, a.

4 = a (1 -2) (1 -3)

4 = a(-1) (-2)

4 = 2a

a = 2.

So, the required equation is y = 2 (x - 2) (x - 3).

Learn more about quadratic functions here:

brainly.com/question/14538087

#SPJ7

7:

A: write and solve an equation that can be used to find the value of x:

B: write and solve and equation that can be used to find the value of y

Answers

Answer:

The Answer is A

Step-by-step explanation:

Hope it helps!

Answer:

The anwser is A. In a way, It's just youre job to try and find out what A stands for, so, that means it is up to you to find the answer, and not us.

Step-by-step explanation:

How would i show the work

Answers

Answer:

I'd recommend writing it out in addition.

Step-by-step explanation:

5 x 12 = 12 + 12 + 12 + 12 + 12 = 60, and so on so forth.

Multiply
8.12.30.3

Please help me

Answers

Answer:

8640

Step-by-step explanation:

Other Questions
7th grade English Question An interjection can be set apart byAa comma.Ba number.Cparentheses.Dquotation marks. Find the volume of the cube shown at the right. h=6in When plants that are true breeding for different traits of acharacteristic are crossed, the trait observed in the first generationis called thea. dominant trait.b. recessive trait.c first-generation trait.d. second-generation trait. The height of a rocket is modeled by h(t) = -(4t-12)(4t-36). How long after reaching its maximum height does it take for the rocket to hit the ground?A. 3 secondsB. 4.5 secondsC. 7.5 secondsD. 12 seconds what is the product of the polynomials below? (8x^2-4x-8)(2x^2+3x+2) How many different 5-letter words can be madea. if the first letter must be A or Y and no letter may be repeated?b. if repeats are allowed (but the first letter is A or Y)?c. How many of the 5-letter words (starting with A or Y) with no repeats endin H? what information did the Zimmerman Telegram state that concern the United States when the telegram was intercepted what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? FREE BRAINLIST! Help answer my question about figurative language -Write me a figurative language sentence for each picture Answer the question in the picture plz Happy Paws charges $20.00 plus $3.50 per hour to keep a dog during the day. Woof Watchers charges $10.00 plus $4.75 per hour. Complete the equation and solve it to find for how many hours the total cost of the services is equal. Use the variable h to represent the number of hours. (the)______ edificios LasLosElLa Malcolm has decided that he wants to open up his own law practice. The time has come to establish prices for his services. Due to his extensive experience and legal background, he believes that his fees should not relate directly to the time or effort spent on specific cases. Now that Malcolm has chosen the pricing strategy he wants to use, what is his next step Does this table show a proportional relationship? If so, what is the constant of proportionality? If not, explain. How did the Sepoy Rebellion disprove the claims made in Clive's letter? O Few Indian troops ever joined to serve with the BNish. O Indian troops fought against the British because they felt poorly treated. O Indian troops refused to fight a battle that would have won India for Britain. 3. Mark each of the following statements, regarding the WTO, as true or false. If false, correct the statement. a. ______ The WTO was formed by countries that conduct the majority of international trade. b. ______ The WTO seeks to increase import quotas and reduce import and export tariffs. c. ______ The WTO seeks to eliminate restrictions on the flow of money between countries. d. ______ Though it can hear accusations, the WTO cannot order remedies Approximate the correlation of the data shown below?a.0b.1c.-0.8d.-1 Assume a company is preparing a budget for its first two months of operations. During the first and second months it expects credit sales of $48,000 and $76,000, respectively. The company expects to collect 60% of its credit sales in the month of the sale and the remaining 40% in the following month. What is the expected cash collections from credit sales during the first month You would expect a cell with extensive Golgi apparatus to A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statements is supported by the phylogenetic tree shown here? Select ALL that apply.A) M. bicolor and M. parma are in the same subspecies category. Eliminate B) M. agilis and M. eugenii share the most recent common ancestor.C) T. thetis and P. xanthpus share the most characteristics in common. D) T. thetis and P. xanthpus share the greatest number of taxa levels than other species. E) M. agilis and M. eugenii share the greatest number of taxa levels than other species. Steam Workshop Downloader